You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
yqbA [2019-06-28 09:55:39]
similar to phage-related protein
Genomic Context
categories
[category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element][category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]Gene
Coordinates
2,686,770 2,688,302
The protein
Protein family
PBSX subfamily (according to Swiss-Prot)Expression and Regulation
additional information
translation is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]Biological materials
Mutant
BKE26180 ([gene|12661F79EA61EA386D73923234009C6E9BF62C31|yqbA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTAACAGATTTTTTTGACA, downstream forward: _UP4_GATGTTCTGGAGGATTTGAABKK26180 ([gene|12661F79EA61EA386D73923234009C6E9BF62C31|yqbA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTAACAGATTTTTTTGACA, downstream forward: _UP4_GATGTTCTGGAGGATTTGAA